work education class 12 cbse

If NCERT website is not working properly in your device kindly clear your browser cache, cookies, temp files and retry click to know more.

• Skip to main content |
• Skip to navigation |
• Screen Reader Access |
• Text Size: A- | A | A+
• Site View: A A

Textbooks PDF (I-XII)

• Sample Paper
• Question Paper
• NCERT Solutions
• NCERT Books
• NCERT Audio Books
• NCERT Exempler
• Model Papers
• Past Year Question Paper
• Writing Skill Format
• RD Sharma Solutions
• HC Verma Solutions
• CG Board Solutions
• UP Board Solutions
• Careers Opportunities
• Courses & Career
• Courses after 12th

Home » 12th Class » CBSE Class 12 Work Experience Syllabus 2024 (PDF) – Download Here

CBSE Class 12 Work Experience Syllabus 2024 (PDF) – Download Here

CBSE Class 12 Work Experience Syllabus 2024 has been released. You can now download the CBSE Class 12th Work Experience Syllabus PDF from here on aglasem. The Central Board of Secondary Education has published the CBSE Class 12 Syllabus for Work Experience subject. It includes all topics to study in 12th standard from NCERT book of Work Experience. Therefore if you are studying in class 12, then download this Work Experience syllabus to know what to study to learn and prepare for your exams.

CBSE Class 12 Work Experience Syllabus 2024

The CBSE syllabus for class 12 for Work Experience is as follows.

CBSE Class 12 Work Experience Syllabus 2024 PDF Download – Click Here to Download Syllabus PDF

CBSE Class 12 Work Experience Syllabus 2023-24 PDF

The complete curriculum is as follows.

CBSE Class 12 Syllabus 2024

You study more subjects besides Work Experience in 12th class. Thus the subject-wise syllabus for CBSE board students who are in class 12 are as follows.

• Accountancy
• Applied Mathematics
• Bio Technology
• Business Studies
• Carnatic Music
• Computer Science
• Engineering Graphics
• English Core
• English Elective
• Entrepreneurship
• General Studies
• Heaths and Physical Education
• Hindi Elective
• Hindustan Music
• Home Science
• Infomatics Practices
• Knowledge Tradition Practices India
• Legal Studies
• Mathematics
• Physical Education
• Political Science
• Sanskrit Core
• Sanskrit Elective
• Urdu Elective
• Work Experience

CBSE Syllabus 2023-24

The class wise syllabus for CBSE board are as follows.

CBSE Class 12 Work Experience Syllabus 2024 – An Overview

The important things to know about this curriculum are as follows.

If you have any queries on CBSE Class 12 Work Experience Syllabus 2024, then please ask in comments below.

To get study material, exam alerts and news, join our Whatsapp Channel .

CBSE Class 12 Knowledge Tradition Practices India Syllabus 2024 (PDF) – Download Here

Cbse class 12 syllabus 2024 (pdf) – download for all subjects, related posts.

Tamil Nadu Board Class 12 Previous Year Question Paper (PDF) – Download Tamil Nadu Board Question Papers

Tn 12th public exam tamil question paper 2023 (pdf), tn 12th public exam sanskrit question paper 2023 (pdf), tn 12th public exam office management & secretaryship question paper 2023 (pdf), leave a reply cancel reply, cbse board quick links.

• CBSE Date Sheet
• CBSE Result
• CBSE Syllabus
• CBSE Sample Papers
• CBSE Question Papers
• CBSE Practice Papers

CISCE Board Quick Links

• CISCE Time Table
• CISCE Results
• CISCE Specimen Papers
• CISCE Syllabus
• CISCE Question Papers

Class Wise Study Material

Board exams 2023.

• Solved Sample Papers
• Revision Notes
• State Board

Study Material

• Class Notes
• Courses After Class 12th
• JEE Main 2023
• Fashion & Design
• Terms of Use
• Privacy Policy

© 2019 aglasem.com

Discover more from AglaSem Schools

Subscribe now to keep reading and get access to the full archive.

Continue reading

• Top Colleges
• Top Courses
• Entrance Exams
• Admission 2024
• Study Abroad
• Study in Canada
• Study in UK
• Study in USA
• Study in Australia
• Study in Germany
• IELTS Material
• Scholarships
• Sarkari Exam
• Visual Stories
• Write a review
• Login/ Register
• Login / Register

Work Education: Meaning, Importance, Skills, Objectives

Pallavi Pradeep Purbey ,

Mar 4, 2024

Share it on:

Work education provides students with exposure to social and economic activities inside and outside the classroom. It helps them understand and build skills related to work education which will help them uplift themselves and be independent.

Work Education comprises activities consisting of services, foods, and community development in various areas of human needs such as health and hygiene, food, clothing, recreation, and social service in accordance with the mental abilities and manual skills of children at various stages of education.

Work education results in services valuable to the community, besides the gratification of self-fulfillment. It focuses on building manual characters. The main objective of work education is to ensure a greater sense of worldly knowledge and develop respect for workers among the students.

Table of Contents

What is Work Education?

Why work education, objectives of work education, importance of work education, advantages of work education, list of activities in work education.

Work education is the nature of knowledge that provides an identical significance to the community and social services by creating consciousness for the wellbeing of the people and society. An essential concept of work education is that it has a manual spirit. Therefore, work education plays an emphasis on learning while working in any field.

Below are some features of Work Education.

• Work education provides both knowledge and skills through understandable and graded programs and helps people enter into a world of work.
• It acts as a different curricular area for offering children opportunities for participating in social and economic activities inside and outside the classroom.
• The prolific manual work situations are drawn from health and hygiene, food, shelter, clothing, recreation, and community service.
• The skills to be developed in this field should comprise knowledge, understanding, practical skills, and values throughout need-based life activities.
• Pre-vocational education should get a prominent place at work education to let students choose various activities according to their interests.

Also Read:  10 Problem Solving Courses You Must Enrol Into Right Now

Work Experience has been named as Work Education and thus makes it a fundamental part of education. It develops;

• Personality.
• Positive work values.
• Constructive habits.

Moreover, work education conveys crucial knowledge related to career and develops proper work skills which can help the children to become productive in meeting their day to day activities.

Work Education helps students develop skills like work values, productivity, and self-reliance. In addition, work education allows students to identify their natural interests and aptitudes in selecting suitable courses of study.

Also Read:  What is a Junior College? Here's What to Know

Work education has specific objectives, which are very important to give the right direction to people and the community. It acts as a vital part of the learning process resulting in goods or services considered valuable to the community. Work education focuses on teaching various socially desirable values such as;

Below is the list of objectives of work education.

• Identify the needs of every individual and their family and community concerning food, health, and hygiene to understand the working environment.
• Familiarize oneself with productive activities in the community in various sectors. It helps in gathering information about various activities in society.
• Know the sources of raw materials and understand the use of tools and equipment to produce goods and services by workers. It helps in gathering essential information.
• Develop skills for the assortment, procurement, arrangement, and utilization of tools and materials for different forms of productive work. It also helps in incorporating new skills.
• Develop self-esteem and confidence through accomplishment in productive work and services.
• Develop a deeper opinion for the environment and wisdom of belonging, responsibility, and commitment to society. It helps in developing a sense of belongingness within people.
• Develop reverence for manual work and regard for manual workers in the community to give them the utmost respect.
• Develop work habits such as punctuality, honesty, discipline, efficiency, and dedication to duty.
• Develop self-esteem and self-assurance through achievements in productive works and services in various fields.
• Develop a deeper apprehension for the environment and a sense of belongingness, responsibility, and commitment to society to ensure the community's welfare.
• Develop alertness of socio-economic problems of the society to ensure people about the changes if made.

Also Read: Buddhist Education System in India: Meaning, Objectives, Subjects

Work education is regarded as very important, meaningful, and the ongoing manual work is organized as a vital part of teaching-learning procedures that are functional to society and the satisfaction of doing work. It is essential for all education segments, i.e., primary, secondary, higher secondary, and higher education. Work education can be granted through a well-developed, channeled, and structured program.

Work education is an integral part of education as,

• It helps to bridge the gap between manual workers and white-collar workers in society.
• Work education gives respect to all types of workers in all sectors, and also creates social awareness for the welfare of society.
• It builds coordination in hand actions and brain activities.
• Work education promotes socially useful physical labor by inheriting educational activities in various fields.
• It acts as a necessary and significant factor in learning different activities and the processes to pursue a particular objective.
• Work education is discernible in the form of valuable services and productive work for the community.
• It is associated as a necessary factor with all the aspects of knowledge in a multi-level education system.
• Work education is based on the principle of learning by doing and practicing.

Also Read:  Importance of Adult Education

Work education aids in various factors to the students and the people who are looking to work in varied areas. Students gain a plethora of knowledge about almost every field, and strategies are built on understanding and practicing such education. In addition, students are involved in activities that help them understand the concept of work education.

Below is the list of advantages of work education.

• Work education links classroom learning to the real world and makes students practice various activities.
• Work education gives opportunities to perform skills in real-world scenarios beyond theoretical learning.
• Work education helps students develop soft skills for the better manifestation of gifts.
• Work education gives students a chance to watch professionals in action entitled to work in various activities.
• It helps students associate with potential employers to broaden their network. And it leads to increased student enrollment with varied skills.
• Motivates students to understand and comprehend working areas.
• Work education provides opportunities for individualized instruction to perform skill-based activities. And it gets the community involved by providing an array of exciting work.
• Work education builds a pool of skilled workers to make the empire rise.
• Teaches soft skills that help in maintaining patience while working.
• Work education lowers recruitment costs for employers as there are people who would be highly skilled in a limited number of activities.

Also Read:  What is Quality Education? Meaning and Importance

Work education includes activities of services, foods, and community development. It focused on health and hygiene sectors, food, clothing, recreation, and social service in harmony with children's mental abilities and manual skills related to work education. Below is the list of activities any person can enroll themselves in.

• Computer Education
• Drawing and Painting
• Work Experience
• Western Music
• Vocal Music
• Knitting and Stitching
• Gadgets learning
• Western Dance
• Creative Thinking
• General Assembly
• Sports and Games
• English Lab
• Smart Class
• Classical Dance
• Instrumental Music

Work education encourages children to know the needs of themselves, their families, and society. The aim is to build students' personalities to have a successful life by having moral values in their pocket of energy.

Also Read:  Top 10 Benefits of Environmental Education 2024

Who gave the concept of work education?

What is called work education?

What is the history of work education?

POST YOUR COMMENT

Related articles.

ICAI Online Registration 2024: Application Form Correction, Documents Required, Exam Dates

NBE 2024: Exam Date, Admit Card, Syllabus, Result, Login

GATE Qualifying Marks 2024: Passing Marks, Admission Cutoff

GUJCET Passing Marks 2024: Check Course Wise Eligibility Criteria

New National Education Policy 2024: Issues And Challenges

IMT Ghaziabad Top Alumni | List of Distinguished Alumni

AP EAMCET 2024: Newspaper Notification (out), Registration Begin (Mar 12)

Get Free Scholarship worth 25000 INR

Work Integrated Learning IT Class 12

Teachers and Examiners collaborated to create the Work Integrated Learning IT Class 12 . All the important MCQs and QA are taken from the NCERT Textbook Web Application 803 .

Important Work Integrated Learning IT Class 12 MCQ & QA

1. GUI stands for ____________. a. Graphical User Interface b. Graphic User Interaction c. Graphic User Interface d. None of the above

2. Which codes and attributes provide an automatically feature __________. a. IntelliSense b. Navigate c. Built – in support d. All of the above

3. _________ extends the capability of the main program. a. IntelliSense b. Add-ins c. Built – in Support d. All of the above

4. You can download a variety of Add-ins from ___________ websites. a. https://msdn.microsoft.com b. https://webassist.com c. https://expressionextras.com d. All of the above

5. _________ are pieces of program re-used by most developers. a. IntelliSense b. Add-ins c. Snippets d. None of the above

6. ________ helps to reusing the code multiple times in the webpages. a. IntelliSense b. Add-ins c. Snippets d. None of the above

7. Snippets are available in which programming languages ___________. a. CSS b. HTML c. JavaScript & JQuery d. All of the above

8. _________ template helps to create an attractive website. a. PPD template b. PSD template c. PRD template d. None of the above

9. Extension of the photoshop file ___________. a. .PSD b. .DOC c. .PDF d. .XLS

10. In the MEW software _________ is a special feature that can be used for updating an image whenever the original photoshop image is modified. a. Command Image b. Compatibility Image c. PSD Image d. None of the above

11. _________ helps to apply special effects to web pages just as in presentation software. a. Slide Transitions b. Web Transitions c. Page Transitions d. All of the above

12. Add-ins are available on the _________ menu. a. View b. Tools c. Edit d. Insert

13. Snippets can be accessed from ________ menu. a. View b. Tools c. Panels d. Insert

14. PSD can be imported from the _____ menu. a. File b. Tools c. Edit d. Insert

15. Page Transitions is available on the _____ menu. a. View b. Tools c. Format d. Insert

16. DWT stands for _________. a. Digital Web Template b. Dynamic Web Template c. Dynamic Web Text d. None of the above

17. Templates help you organize the entire website to have a consistent look and feel. This is very helpful when you work with a large number of web pages. a. Templates b. Image Editing c. Embedding d. None of the above

18. ________ helps to create a dynamic website with fixed positions for common elements. a. Static Web Template b. Dynamic Web Template c. Auto Web Template d. None of the above

19. SEO stands for _______________. a. Search Ending Optimization b. Search Engine Option c. Search Engine Optimization d. None of the above

20. We can get a better search ranking of our website using __________. a. SEO b. SOE c. SSD d. SSL

21. Search engines crawl a website using _____________. a. Web b. Spider c. Reader d. None of the above

22. With the help of ___________ we can Index the website in the search engine. a. Page Title b. Page Description c. Page Keyword d. All of the above

23. Page title maximum ________ characters are displayed in search results. a. 60 b. 70 c. 80 d. 90

24. Page description can contain maximum ___________ characters in the search engine. a. 128 b. 130 c. 156 d. 180

25. Using HTML and CSS you can create __________ web page. a. Static b. Dynamic c. Both a) and b) d. None of the above

26. If you want to create a dynamic web page you require __________ language. a. ASP b. PHP c. JavaScript d. Any one from above

27. Data filled using a form can be stored in a _________. a. Data System b. Data Base c. Data Container d. None of the above

28. IIS stands for _____________. a. Internal Information System b. Internet Information Services c. Internet Information System d. None of the above

29. The database is stored in a special folder with the name __________. a. DB b. Data c. Fbdb d. None of the above

30. ________ is the product that was replaced by Microsoft Expression Web. a. Dreamweaver b. Microsoft FrontPage c. Sublime Text d. None of the above

31. What are the standard procedures to be followed before publishing a website. a. Examining Structure of a website b. Estimating Size of a website c. Removing slow page d. All of the above

32. Create a visual diagram of hyperlinks of a website. This helps you understand the ____________. a. Navigation structure b. Broken Links c. Both a) and b) d. None of the above

33. If website size is more then the standard size it will take ________? a. More time to load b. Website will slowdown c. Both a) and b) d. None of the above

34. To clean up your web page for any unnecessary code is known as _________. a. Code Sequence b. Code Optimization c. Code clean up d. None of the above

35. ________ helps the content to store in a web server to be viewed by the public. a. Hosting b. Uploading c. Downloading d. None of the above

36. Web hosting providers allow publishing to upload the website through _________. a. FTP b. HTTP c. SSL d. None of the above

37. _________ feature helps to transfer contents of your entire website to a remote computer. a. Web Helper b. Web Package c. Web Content d. None of the above

38. Give the example of Web Authoring Tools? a. KompoZer b. Dreamweaver c. Both a) and b) d. None of the above

39. What are the popular templates available for creating attractive websites? a. CSS Templates b. XHTML/CSS Template c. PSD Template d. All of the above

40. Explain the purpose of Add-ins.?

Answer – Any third-party software programming or script that is added to a programming to give it extra features and abilities is known as an add-ins. Some of the popular add-in websites are – a. https://msdn.microsfot.com b. https://webassist.com c. https://dotnetcurry.com d. https://expressionextras.com e. https://bootstrap.com

41. What is a snippet?

Answer – Snippets are small pieces of code that most developers reuse. Snippets are useful because they allow you to reuse the same code across several web pages or websites, it saves time and work.

42. What do you mean by PSD templates?

Answer – Photoshop Document (PSD) is an image format that allows multiple layers of graphics to be combined into a single file. PSD templates help to design attractive websites. You can download PSD template from – a. https://www.psdtemplates.com b. https://www.freepick.com

43. What is page Transitions?

Answer – You can use special effects on web pages in the same way that you can in presentation software. This aids in the presentation of special effects to visitors.

44. What is a Dynamic Web Template?

Answer – A Dynamic Web Template is based on an HTML Web page. It may include editable page layouts, page elements, settings, formatting, styles, graphics, and specific effects. A dynamic web template’s goal is to derive or build pages in a web site based on it in order to keep a uniform and consistent appearance and feel throughout the site.

45. What is Search Engine Optimization?

Answer – In simple terms, it refers to the process of upgrading your website in order to boost its exposure when consumers use Google, Bing, and other search engines to look for products or services linked to your business.

46. How does search engine optimization work? Answer – Bots are used by search engines like Google and Bing to crawl the web, moving from site to site, collecting information about those sites, and indexing them.

47. What are the different factors important to rank the website?

Answer – The different factors which is important to rank a website are – a. Page Title (Not more than 70 characters) b. Page Description (Not more then 156 characters) c. Keywords d. Page Headers e. Internal & External Links f. ALT text in image file

48. What is frontpage Server Extensions?

Answer – FrontPage Server Extension is a software that allows the frontpage client to connect to the server. Many web hosting servers use FrontPage Server Extensions.

49. What is a web server?

Answer – A web server is responsible for storing the website’s files, which include all HTML documents as well as their associated assets, such as photos, CSS stylesheets, JavaScript files, fonts, and video.

50. What is a database?

Answer – A database is a collection of data that has been arranged so that it can be simply accessed and controlled. To make it easier to access relevant information, you can organize data into tables, rows, and columns.

51. What are the standard procedures to publish the website?

Answer – The standard procedures to publish the website are – a. Examining Structure of a website – Check all the internal and external links before publishing. b. Estimating Size of a website – Always reduce the size of the website, More size will create more loading time. c. Removing slow pages – In the website if any slow page is there remove the page or rectify the page otherwise it will create problems for visitors.

52. What are code optimizations?

Answer – Code optimizations means to clean up unwanted program code from a website.

53. What is web hosting?

Answer – To be viewed by the general public, the content must be hosted on a web server. There are a number of free web hosting services available that will give you free online space for your content.

Important Links 

Employability skills.

Communication Skills Class 12 MCQ

Communication Skills Class 12 Questions and Answers

Self Management Skills Class 12 MCQ

Self Management Skills Class 12 Questions and Answers

ICT Skills Class 12 MCQ

ICT Skills Class 12 Questions and Answers

Entrepreneurial Skills Class 12 MCQ

Entrepreneurial Skills Class 12 Questions and Answers

Green Skills Class 12 MCQ

Green Skills Class 12 Questions and Answers  

Web Application and Security 

Movie Editing Tools Class 12 MCQ & QA

Customizing and Embedding Multimedia Components in Web Pages Notes Class 12

Web Scripting JavaScript Class 12 MCQ

Web Scripting JavaScript Class 12 Questions and Answers  

Reference Textbook

The above Work Integrated Learning IT Class 12 was created using the NCERT Book and Study Material accessible on the CBSE ACADEMIC as a reference.

Your valuable Feedback

Hi Students, Thank you for taking the time to reading Work Integrated Learning IT Class 12 . Please take a few moments and leave your thoughts in the comment box below.

Disclaimer – 100% of the questions are taken from the CBSE textbook Work Integrated Learning IT Class 12 , and our team has tried to collect all the correct MCQs and QA from the textbook . If you found any suggestion or any error please contact us [email protected].

Talk to our experts

1800-120-456-456

• CBSE Marking Scheme for Class 12

Exam Pattern and Marking Scheme for Class 12 CBSE 2023-24 for All Subjects

The Central Board of Secondary Education(CBSE) has released the marking scheme Class 12 2023-24 for all subjects on its official website. For the student's ease, we have provided CBSE marking scheme 2024 Class 12 along with the chapter-wise weightage of each subject on this page. We suggest you read the article till the end to get all the comprehensive details of the weightage of all the subjects, exam pattern, and chapter wise marking scheme class 12. Knowing the marks distribution, exam pattern, and weightage will help you prepare better for the upcoming Class 12 board exams and increase your chances of scoring more marks in board examinations.

The minimum aggregate marks a candidate must score to pass CBSE Class 12 board exams is 33%. Moreover, the candidate must also secure at least 33% marks in each subject to pass the board exam. Candidates who secure 33% or above aggregate marks but scored less than 33% in any subject must appear for the supplementary exam.

CBSE Class 12 Assessment Policy 2024

The Central Board of Secondary Education has announced that there will be only one term or one board examination in the academic year 2023-24. The final Class 12 board exam covers the entire CBSE syllabus as per the curriculum designed by the board for the year 2023-24.

CBSE Class 12 Exam Pattern 2023-24

The Central Board of Secondary Education has released a new exam pattern and chapter wise marking scheme class 12 for the academic year 2023-24 . Here are the complete details for the same:

Maths Exam Pattern and Marking Scheme for Class 12 CBSE 2023-24

Cbse class 12 maths unit-wise weightage , physics exam pattern and marking scheme for class 12 cbse 2023-24, cbse class 12 physics unit-wise weightage , chemistry exam pattern and marking scheme for class 12 cbse 2023-24, cbse class 12 chemistry unit-wise weightage , biology exam pattern and marking scheme for class 12 cbse 2023-24, cbse class 12 biology unit-wise weightage, accountancy exam pattern and marking scheme for class 12 cbse 2023-24, economics exam pattern and marking scheme for class 12 cbse 2023-24, english core exam pattern and marking scheme for class 12 cbse 2023-24, political science exam pattern and marking scheme for class 12 cbse 2023-24, cbse class 12 political science unit-wise weightage .

This was the complete discussion on the Marking Scheme of CBSE Class 12 for the academic year 2023-24. 

The CBSE marking scheme 2024 Class 12, as elucidated by Vedantu, follows the pattern set in the 2023 scheme. The distribution of marks is a crucial aspect, shaping the evaluation process. Vedantu provides valuable insights into the CBSE marking scheme, aiding students to comprehend the weightage assigned to each section. The intricate details of CBSE marks distribution for class 12 scheme 2024, as per Vedantu, empower students to strategize their exam preparation effectively. It is advisable for students to thoroughly grasp this marking scheme to enhance their performance in the upcoming exams, ensuring a comprehensive understanding of the evaluation criteria.

We hope students have found this helpful information for their studies. Stay tuned with Vedantu for further latest updates on CBSE Class 12  and other competitive exams.  Good Luck!

FAQs on CBSE Marking Scheme for Class 12

1. When will the CBSE board conduct the Class 12 board examination for the academic session 2023-24?

The CBSE board will tentatively conduct Class 12 board exams from February 15, 2024 .

2. Is it mandatory to pass Class 12 theory and practical exams separately?

Yes, it is mandatory to clear both practical and theoretical exams separately.

3. How does the CBSE Class 12 marking scheme help students?

The CBSE  Class 12 marking scheme will help students understand how the marks will be allocated for each step of a question. With this information, students will learn the importance of answering a question in steps. This eventually helps them to enhance their writing skills.

4. How to check all subjects' CBSE Class 12 marking scheme?

Follow the below to check the CBSE Class 12 marking scheme for all subjects:

Step 1: Visit CBSE's official website (http://cbseacademic.nic.in/index.html).

Step 2: Click on the “SQP 2023” under the “ Sample Question Paper” Tab.

Step 3: Select Class 12 by clicking on the link

Step 4: Click on the particular subject for which you want the marking scheme and sample paper. Download sample paper and take out the marking scheme printout for future reference.

5. Does the CBSE board consider the pre-board exam marks when calculating the final Class 12 exam results? 

No, the pre-board examination scores are not added to or considered when calculating the final board exam results.

6. What is the marking system of CBSE Class 12?

The CBSE Class 12 marking system incorporates both marks and grades:

Total Marks:

Each subject has a maximum of 100 marks.

Practical subjects (like Physics, Chemistry, and Biology) have 70 marks for theory and 30 marks for practical exams.

Commerce subjects (Accountancy, Business Studies, and Economics) have 80 marks for theory and 20 marks for project work.

Mathematics has 80 marks for the written exam and 20 marks for internal assessment.

7. How will CBSE Class 12 marks be calculated?

CBSE uses a five-cum-nine point scale, assigning grades from A (highest) to E (lowest).

Grades are based on a combination of absolute marks and percentiles.

8. What is the criteria for Class 12 CBSE exam marks?

Students need to score a minimum of 33% in each subject and overall to pass the exam.

9. What is the marking scheme of Class 12 2023?

The marking scheme for each subject is released by CBSE every year, typically a few months before the exams. It provides detailed instructions on how marks are distributed for different sections of the question paper. You can find the latest marking schemes on the official CBSE website or through educational portals.

CBSE Board Exam 2024 Highlights: Class 12 Economics Exam Was Simple And Well Balanced, Says Teacher

Cbse board exam 2024 live: class 12 exams will be held until april 2 while class 10 exams concluded on march 13..

CBSE Board Exam Live Updates

The Central Board of Secondary Education (CBSE)  conducted Class 12 Economics paper today, Monday, March 18, 2024. The exam began at 10.30am and ended around 1.30pm. This year, a total of 39 lakh students from 26 countries are taking the examinations. In the national capital, the exams are being held at 877 centers, with 5.80 lakh students appearing. Students taking the examination have been advised to arrive at the center at least 30 minutes before the commencement of the exam. They must not forget to carry their admit card as it is a crucial document. Candidates without admit cards will not be allowed to enter the examination hall. Students must also bring their own stationery as borrowing in the examination hall is not permitted. Prohibited items should not be brought into the examination hall, as doing so may result in cancellation of the exam. CBSE commenced conducting board exams for Classes 10 and 12 starting February 15. Class 12 exams will be held until April 2 while Class 10 exams concluded on March 13.

Here are the LIVE updates on the Board Exam:

• Students should abstain from spreading fake news regarding paper leaks or other matters.
• Familiarise themselves with exam guidelines before the exam.
• Know your concentration span, Study with breaks.
• Students must work out best time for concentration.
• They must hold group study for difficult subjects.
• Students must not be discouraged by previous results. They must try to identify their weak areas from previous exams and work on them.
• Students must make time management plan for all subjects.
• They must repeat their learnt work so the recall in exam is easy. Work not repeated or revised is easily forgotten.
• Students must plan their revision time by drawing up a timetable. The timetable should also include activities such as playing, walking, watching TV that help in relaxation.

Track Budget 2023 and get Latest News Live on NDTV.com.

Track Latest News Live on NDTV.com and get news updates from India and around the world .

Track Latest News and Election Results Coverage Live on NDTV.com and get news updates from India and around the world.

Watch Live News:

• Bihar Board

SRM University

नए भारत का नया उत्तर प्रदेश.

• Bihar Board Result 2024
• UP Board Result 2024
• CBSE Board Result 2024
• MP Board Result 2024
• Rajasthan Board Result 2024
• Shiv Khera Special
• Education News
• Web Stories
• Current Affairs
• School & Boards
• College Admission
• Govt Jobs Alert & Prep
• GK & Aptitude
• CBSE Class 12

CBSE Class 12 Biology Exam Tomorrow: Practise the Most Repeated Questions for High Score, Download PDF

Previous year questions of biology class 12: check questions from cbse class 12 biology previous years’ exams to revise important topics for the upcoming board exam. download  cbse class 12 biology most repeated questions for all chapters in pdf..

CBSE Class 12 Biology Most Repeated Questions: As the CBSE Class 12 Biology board exam approaches, students are gearing up to revise all key areas and excel in the exam. Practising repeated questions serves as a strategic approach to reinforce key concepts and improve problem-solving skills. As CBSE often repeats questions in board exams directly or indirectly, revisiting frequently asked questions ensures that students are well-prepared to tackle any challenge that may arise in the examination hall.

• Section A will have 16 questions of 1 mark each.
• Section B will have 5 questions of 2 marks each.
• Section C will have 7 questions of 3 marks each.
• Section D will have 2 case-based questions of 4 marks each.
• Section E will have 3 questions of 5 marks each.

CBSE Class 12 Biology Most Repeated Questions

1 mark questions.

1.Which one of the following processes results in the production of

recombinants in future generations ?

(i) Mutation (ii) Independent assortment during meiosis I

(iii) Independent assortment during meiosis II (iv) Crossing over of bivalents

(a) (iv) only (b) (ii) and (iv)

(c) (i), (ii) and (iii) (d) (i), (ii), (iii) and (iv)

2.Study the DNA profiles obtained as a result of DNA fingerprinting of a

child 'X' and three individuals 1, 2 and 3. Which one of the following options shows the possible parents of the child 'X'?

Child Individual Individual Individual

(a) 1 and 2

(b) 2 and 3

(c) 1 and 3

(d) Only individual 3

3.The organism used in construction of the first artificial recombinant DNA by Cohen and Boyer in 1972 was :

(a) E. coli (b) Salmonella typhimurium

(c) Agrobacterium tumefaciens (d) Bacillus thuringiensis

Select the correct answer to these

questions from the codes (a), (b), (c) and (d) as given below. (a) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).

(b) Both Assertion (A) and Reason (R) are true, but Reason (R) is not

the correct explanation of the Assertion (A).

(c) Assertion (A) is true, but Reason (R) is false.

(d) Assertion (A) is false, but Reason (R) is true.

4.Assertion (A) : A patient of ADA deficiency undergoing treatment for gene therapy requires periodic infusion of genetically engineered lymphocytes.

Reason (R) : Lymphocytes are immortal.

5.Assertion (A) : A cattle egret and grazing cattle in close association is a classic example of commensalism.

Reason (R) : As grazing cattle move through the field, they stir up and flush out insects from the vegetation that otherwise might be difficult for egrets to find and catch.

6.Mention two functions of codon AUG.

7.What is economic value of Spirulina?

8.Name the organism commercially used for the production of single cell protein.

9.Write full form of ELISA.

CBSE Class 12 Biology Sample Paper for Board Exam 2024

2 Marks Questions

1.(i) Identify and name the structures 'A' and 'B' marked in the image given below:

(ii) State their importance in various biotechnology experiments.

2.A human being suffering from Down’s syndrome show trisomy of 21st chromosome. Mention the cause of this chromosomal abnormality.

3.In a dihybrid cross, when would the proportion of the parental gene combinations be much higher than non-parental type as experimentally shown by Morgan and his group.

4.A tall Pea plant with yellow seeds (heterozygous for both) is crossed with a dwarf Pea plant with green seeds. Using a Punnet square work out the cross to show the phenotypes and the genotypes of F1 generation.

5.The length of a DNA molecule in a typical mammalian cell is calculated to be approximately 2.2 meters. How is the packaging of this long molecule done to accommodate it within the nucleus of the cell.

6.Name any two vertebrate body parts that are homologous to human fore-limbs.

7.Name the type of human cell HIV attacks at its entry into the body. Explain the events that occur in the cell which further lead to cause immunodeficiency syndrome.

8.Name one plant and the addictive drug extracted from its latex. How does this drug affect the human body?

9.Why is Rhizobium categorized as a ‘symbiotic”?

10.Biotechnologists refer to Agrobacterium tumefaciens as a natural genetic engineer of plants. Give reason to support the statement.

11.Expand the name of enzyme ADA. Why is the enzyme essential in the human body? Suggest a gene therapy for its deficiency.

3 Marks Questions

1.(a) (i) Expand the abbreviations given below, used for different modes of assisted reproductive technologies :

(1) ZIFT (2) ICSI (3) IUT (4) GIFT

(ii) Which one of them cannot be considered as a procedure of IVF? Give reasons in support of your answer.

2.(b) Differentiate between the following : 

(i) Perisperm and Pericarp

(ii) Syncarpous pistil and Apocarpous pistil

(iii) Plumule and Radicle

3.(a) Expand IUD (b) Why is hormone releasing IUD considered a good contraceptive to space children?

4.Explain the zygote intrafallopian transfer technique (ZIFT). How is intrauterine transfer technique (IUT) different from it?

5.Q.37 Give reasons why (i) Most zygotes in angiosperms divide only after certain amount of endosperm is formed. (ii) Groundnut seeds are exalbuminous and Caster seeds are albuminous. (iii) Micropyle remains as a small pore in the seed coat of a seed. (iv) Integuments of an ovule harden and the water content is highly reduced as the seed matures. (v) Apple and Cashew are not called true fruits.

6.A snapdragon plant homozygous for red flower when crossed with a white flowered plant of the same species produced pink flowers in F1 generation.  (a) What is this phenotypic expression called?  (b) Work out the cross to show the F2 generation when F1 was self-pollinated. Give the phenotypic and genotypic ratios of F2 generation.  (c) How do you compare the F2 phenotypic and genotypic ratios with those of Mendelian monohybrid F2 ratios?

7.(a) Construct a complete transcription unit with promoter and terminator on the basis of hypothetical template strand given below :

(b) Write the RNA strand transcribed from the above transcription unit along with its polarity.

8.How does industrial melanism support Darwin’s theory of Natural Selection? Explain.

9.(a) Natural Selection operates when nature selects for fitness. Explain. (b) The rate of appearance of new forms is linked to the life span of an organism. Explain with the help of a suitable example.

10.List the specific symptoms of pneumonia. Name the causative organism.

11.(a) Why do farmers prefer biofertilizers to chemical fertilizers these days? Explain. (b) How do Anabaena and mycorrhiza act as biofertilisers?

12.EcoRI is used to cut a segment of foreign DNA and that of a vector DNA to form a recombinant DNA. Show with the help of schematic diagrams.

(i) The set of palindromic nucleotide sequence of base pairs the EcoRI will recognize in both the DNA segments. Mark the site at which EcoRI will act and cut both the segments.

(ii) Sticky end formed on both the segments where the two DNA and foreign DNA join later to form a recombinant DNA.

13.Name the interaction in each of the following:

(i) Cuscuta and Shoeflower (ii) Orchid growing on Mango tree. (iii) Whale and Barnacle growing on its back.

5 Marks Questions

1.Meselson and Stahl carried out an experiment to prove the nature of

DNA replication. Recall the experiment and answer the following questions.

 (i) Which two types of nitrogen were used by them in their experiment and why ?

 (ii) Why did they take samples of E. coli at definite time intervals for their observation ?

(iii) State the role of caesium chloride density gradient in their experiment.

(iv) Write the conclusions they arrived at.

2.(i) What is the chemical name of smack? Why is the consumption of smack considered as an abuse?

(ii) Name the source plant and one effect of the following drugs on the human body:

(1) Marijuana (2) Cocaine (3)Morphine

3.(a) Study the diagram given below showing the modes of pollination. Answer the questions that follow.

(i) The given diagram shows three methods of pollen transfer in plants. What are the technical terms used for pollen transfer methods 1, 2 and 3?

(ii) How do the following plants achieve pollination successfully?

(1) Water lily (2) Vallisneria (iii) Flowering plants have developed many devices to avoid inbreeding depression. Explain one hereditary and one physiological device which helps plants to achieve this target.

4.(a) When and where does spermatogenesis occur in a human male?

(b) Draw a diagram of a mature human male gamete. Label the following parts : acrosome, nucleus, middle piece, tail.

(c) Mention the function of acrosome and middle piece.

5.(a) Draw a schematic representation of a transcription unit and show the following in it. (i) Direction in which the transcription occurs (ii) Polarity of the two strands involved (iii) Template strand (iv) Terminator (b) Mention the function of promoter in transcription.

6.Answer the following questions based on Meselson and Stahl’s Experiment. (a) Why did the scientists use 15NH4CI and 14NH4CI as sources of nitrogen in the culture medium for growing E.Coli.? (b) Name the molecule(s) that 15N got incorporated into. (c) How did they distinguish between 15N labeled molecules from 14N ones? (d) Mention the significance of taking E.coli samples at definite intervals for observations. (e) Write the observations made by them from the samples taken at the end of 20 minutes and 40 minutes respectively. (f) Write the conclusion drawn by them at the end of their experiment.

7.(a)Explain Darwinian theory of evolution with the help of one suitable example. State the two key concept of the theory. (b) Mention any three characteristics of Neanderthal man that lived in near east and central Asia.

8.(i) Write the scientific names of the two species of filarial worms causing filariasis. (ii) How do they affect the body of infected persons? (iii) How does the disease spread?

9.(i) Name the two type of lymphocytes involved in the specific immune system. (ii) Mention the two types of specific immunity they generate. (iii) Why is specific immunity considered to be unique in its function? Write any three special features of it.

10.(i) Describe the characteristics a cloning vector must possess. (ii) Why DNA cannot passs through cell membrane? Explain. How is a bacterial cell made competent to take up recombinant DNA from the medium.

11.(a) Name the source from which insulin was extracted earlier. Why is this insulin no more in use by diabetic people? (b) Explain the process of synthesis of insulin by Eli Lilly company. Name the technique used by the company. (c) How is insulin produced by human body different from the insulin produced by the above mentioned company.

Also check:

CBSE Class 12 Biology Syllabus 2023-24

CBSE Class 12 Biology DELETED Syllabus 2023-24

Get here latest School , CBSE and Govt Jobs notification in English and Hindi for Sarkari Naukari and Sarkari Result . Download the Jagran Josh Sarkari Naukri App . Check  Board Result 2024  for Class 10 and Class 12 like  CBSE Board Result ,  UP Board Result ,  Bihar Board Result ,  MP Board Result ,  Rajasthan Board Result  and Other States Boards.

• AP TET Results 2024
• SSC GD Answer Key 2024
• CBSE Class 12 Bio Question Paper 2024
• CBSE Class 12 Biology Answer Key 2024
• CBSE Class 12 Biology Important Diagrams
• GPSC DYSO Result 2024
• BSF Recruitment 2024
• Bihar Sakshamta Pariskha Answer Key 2024
• PNB SO Admit Card 2024
• MPNRC Result 2024

Trending Categories

Latest education news.

Bihar Board Class 12th Result 2024 LIVE: इंतजार खत्म! इस दिन आ सकता है बिहार बोर्ड इंटर रिजल्ट, देखें लेटेस्ट अपडेट

Bihar Sakshamta Answer key 2024 Out: शेष तिथियों के लिए बिहार सक्षमता परीक्षा उत्तर कुंजी bsebsakshamta.com पर जारी, यहां करें चेक

CBSE Class 12 Biology Answer Key 2024 and Question Papers, Download PDF All SETs

AP TET Results 2024: Manabadi Andhra Pradesh TET Scorecard on aptet.apcfss.in

CBSE Class 12 Biology Paper Analysis 2024: Exam Review, Student Feedback and Expert View

CBSE Class 12 Biology Question Paper 2024, All SETs Download PDF

दुनिया का सबसे गहरा सागर कौन-सा है, जानें

GPSC DYSO Result 2024 Released at gpsc.gujarat.gov.in: Download Prelims Cutoff Marks

CBSE Class 12 Biology 2024 Exam LIVE Updates: Question Paper Review and Solutions as Exam get over

Maharashtra Board HSC Sociology Exam 2024: Exam Analysis, Question Paper and Answer Key 2024

SSC GD Answer Key 2024 Live: Constable answer sheet soon at ssc.gov.in

MPNRC Result 2024 for GNM ANM at mpnrc.mp.gov.in: Check Latest Updates Here

You have eagle eyes if you can find a horse in the forest in 7 seconds!

NEET MDS Admit Card 2024 Out Live: nbe.edu.in NBEMS Has Issued the NEET MDS Hall Ticket, Internship Cut-Off Date Extended to June 30

BSEB Sakshamta Pariskha Answer Key 2024 OUT at bsebsakshamta.com, Check Download Link

TN Board Class 12 Maths Paper Analysis 2024: Exam Review, Student Feedback and Expert View

Maharashtra Board SSC Physiology Paper Analysis 2024: Exam Review, Student Feedback and Expert View

Karnataka Board 2nd PUC Class 12 Geography Paper Analysis 2024: Exam Review, Student Feedback and Expert View

Haryana Board HBSE Class 10 Science Sample Paper 2023-24 PDF with Exam Pattern and Marking Scheme

Holi Kab Hai 2024: 25 या 26 मार्च कब है होली ? क्या है सही समय और पंचांग की तारीख, जानें

• Today’s Paper
• Lok Sabha Elections
• Premium Stories
• Express Shorts
• Health & Wellness
• Board Exam Results

CBSE Class 12th Economics Analysis: ‘Tricky questions in section A, B’; full paper here

Cbse 2024 board exams: cbse class 12 economics exam analysis by teachers and feedback received from students after the end of exam..

The Central Board of Secondary Education (CBSE) on March 18 conducted the economics paper of Class 12. The paper was moderate with a mix of direct, analytical and application-based questions, say experts. The difficulty level of the CBSE 2024 the economics Class 12 questions was moderate.

According to Swati Urmil, HOD Economics, Bhai Parmanand Vidya Mandir, there economics paper comprised of application based questions which needed a thorough study and understanding of the topics and chapters.

“Overall the questions were from the prescribed syllabus and entirely based on the pattern of the latest sample paper issued by CBSE,” she added.

Regarding section-wise difficulty level, the HOD further added: “Both section A (Macro Economic Theory) and section B (Indian Economic Development) had tricky one mark and 4 marks questions. The question paper was moderately designed with questions to analyse the student’s conceptual understanding. Overall the paper covered all aspects of the curriculum.”

Read | CBSE appoints bureaucrat Rahul Singh as new Chief

The economics exam was held for 80 marks and was divided into six sections –

20 MCQs (20 marks), 4 short answer type questions (12 marks), 6 short answer type questions (24 marks) and 4 long answer type questions (24 marks).

As per Narsingh Raghav, PGT Commerce, KIIT World School, Gurugram, the economics paper was relatively easy. Regarding difficulty level, Raghav added that the MCQ questions were moderate and tricky, and the questions were value-based.

The direct questions were quite easy to answer, Anupam Agnihotri, PGT Economics at Silverline Prestige School, Ghaziabad said adding that the competency-based questions were average and a few MCQs were a little tricky.

Students were able to attempt the paper on time. The last questions of the case study were on G20 which was also a good question, Agnihotri said.

The questions, according to Soma Bose, HOD Commerce department, VidyaGyan School, based on the case study were a bit vague which made the students confused. Some descriptive questions were a bit lengthy, she added.

• board exams
• CBSE 12th Results

The Election Commission (EC) stood firm in removing six home secretaries from their positions, including Uttar Pradesh's officer Sanjay Prasad, despite objections from the state government. Prasad, a trusted official of Chief Minister Yogi Adityanath, was removed to establish a clear separation between the bureaucracy and ruling party.

• Delhi News Live Updates: Kavitha accused of conspiring with Kejriwal in Delhi excise case; CBI expects high-profile arrests 41 mins ago
• Stock Market Live Updates: Sensex, Nifty open marginally lower 41 mins ago
• GATE 2024 Result Updates: Toppers list released at gate2024.iisc.ac.in 14 hours ago
• JEE Main 2024 Session 2 Live Updates: When will NTA release JEE city slip at jeemain.nta.ac.in? 14 hours ago

Best of Express

Buzzing Now

Mar 19: Latest News

• 01 Gujarat CEO Bharathi chairs meeting with party leaders
• 02 Son-in-law, 4 others held for ‘man’s murder’ in Nandurbar
• 03 BMC to appoint consultant to study cluster redevelopmen, monetisation of leased, tenanted properties
• 04 ‘Campaign can go virtual’: Narmada court rejects Chaitar’s plea to alter bail conditions
• 05 P&G India appoints Kumar Venkatasubramanian as CEO
• Elections 2024
• Political Pulse
• Entertainment
• Movie Review
• Newsletters
• Web Stories

• India Today
• Business Today
• Reader’s Digest
• Harper's Bazaar
• Brides Today
• Cosmopolitan
• Aaj Tak Campus
• India Today Hindi

CBSE Class 12 Economics analysis 2024: Moderate to difficult paper, MCQs tricky

The cbse class 12 economics board exam paper was successfully conducted today. the question paper presented a well-balanced blend of knowledge-based, analytical, and application-oriented questions. check out the in-depth paper analysis here..

Listen to Story

The Central Board of Secondary Education (CBSE) Class 12 Economics paper conducted today, March 18 was well-balanced, comprising questions drawn directly from the NCERT textbook.

According to students, the difficulty level was assessed as moderate.

"The question paper was a balanced mix of knowledge, analysis and application-based questions," says Narsingh Raghav, PGT Commerce, KIIT World School, Gurugram.

"Most of the students were able to complete the paper well in time and also could save some time for revision. The economics examination was for 80 marks, to be attempted within 3 hours," adds Narsingh.

• Section A: Macro Economics
• Section B: Indian Economic Development

Further, both sections in the paper were relatively easy. Regarding difficulty level, MCQ questions were moderate and tricky, and the questions were value-based. Section B was simple with direct answers. The paper was balanced and the one who solved NCERT well could easily answer all the questions. The paper was not at all lengthy. Case-based questions were easy and in the comfort zone for the students. There was no error found in the question paper. The paper consisted of questions ranging from easy to critical. The language was very easy and proper reading of the questions will make it accessible for the students.

Further, Swati Urmil, the Head of Department for Economics at Bhai Parmanand Vidya Mandir, emphasised the presence of application-based questions in the Economics paper.

SECTION-WISE DIFFICULTY LEVEL

• Tata Consultancy Services share price
• 4,020.85 -2.99%
• Tata Steel share price
• 150.10 0.33%
• Bharti Airtel share price
• 1,232.40 0.60%
• Power Grid Corporation Of India share price
• 260.05 -1.87%
• ITC share price
• 410.00 -1.77%

CBSE Results 2024: Class 10 results expected to be out on THIS date. Check all details here

CBSE Results 2024: CBSE Class 10 results is likely to be out be out soon. Last year's pass percentage was 93.12 percent, down by 1.28 percent from 2022.

CBSE Results 2024: The Central Board of Secondary Education (CBSE) is expected to announce CBSE Class 10 Results soon. The CBSE Class 10 exams were conducted from 15 February- 13 March. As per media reports, the Class 10 results are expected to be out in the month of May, however, no official announcement has been made by the board.

Last year, in 2023, CBSE Class 10 results were announced on 12 May and the pass percentage for Class 10 was 93.12 percent, which was down from by 1.28 per cent points since 2022.

Also Read: BPSC TRE 3.0 exam 2024: Bihar School Teacher recruitment exams starts today. Check guidelines for candidates here

Where to check cbse results.

When the results are announced, students can check the results on results.cbse.nic.in and cbseresults.nic.in. In addition to this, the results can also be checked on DigiLocker and UMANG apps using roll number, school number, admit card ID and date of birth.

Also Read: CBSE board exams 2024: Deadline to conduct Class 10, 12 practical exams extended to THIS date. Check notice here

How to check cbse class 10 results 2024.

Visit the official website of other site of CBSE.

Click on CBSE Board Result 2023 link or login to the account.

Enter the roll number or registration number and click on submit.

You can now check the Class 10 results 

Check the result and download the page or take a screenshot.

Also Read: BSEB Bihar Board Result 2024: Class 12th results expected in March-end at biharboardonline.bihar.gov.in

Meanwhile, on 12 March, CBSE urged exam centres to update Online Exam Centre Management System (OECMS) portal. In an official notification it said that many examination centers are still not updating the examination data in the OECMS portal despite instruction. It added that the information is not only used for day-to-day monitoring of conduct of exams but also used for calculating amount payable to various functionaries by the Integrated Payment System (IPS).

“ It may be understood that the OECMS is not merely for submission of absentee statement. In case the school does not submit information for a particular day on OECMS, the payment for that particular day will not be calculated in IPS. The OECMS data is to be submitted daily even if there is no absentee at the centre," the board wrote.

Milestone Alert! Livemint tops charts as the fastest growing news website in the world 🌏 Click here to know more.

Unlock a world of Benefits! From insightful newsletters to real-time stock tracking, breaking news and a personalized newsfeed – it's all here, just a click away! Login Now!

Swiss knife to Lucknow diaries: Four women executives on guilt and success

On the gender scale, business schools still don’t measure up

For B-school grads, a fancy MBA may not be enough. You also need work experience

The ubiquity of India's 'coaching culture', in charts

How to explain the budget to an engineer

Germany, Japan or Korea? Indian students look beyond Canada

Why India's runaway coaching centres need regulating

Mint Explainer: Why Indian schools continue to fail rural teens

Coaching centres may challenge new guidelines

How AR Rahman’s orchestra is tuning lives

Wait for it…

Log in to our website to save your bookmarks. It'll just take a moment.

You are just one step away from creating your watchlist!

Oops! Looks like you have exceeded the limit to bookmark the image. Remove some to bookmark this image.

Your session has expired, please login again.

Congratulations!

You are now subscribed to our newsletters. In case you can’t find any email from our side, please check the spam folder.

Subscribe to continue

This is a subscriber only feature Subscribe Now to get daily updates on WhatsApp

• SQP (Skill Subjects)

SQPs of remaining subjects coming soon.

Back to Top

Top 30+ CBSE Class 12 Physical Education MCQs for Board Exam 2024 with Answers to Secure Good Marks

i mg src="https://img.jagranjosh.com/images/2024/March/932024/CBSE-Class-12-Physical-Education-Important-MCQ.jpg" width="1200" height="675" />

CBSE Board Class 12 Physical Education MCQs (With Answers) 2024:  The CBSE Class 12 Physical Education Board exam 2023–24 is scheduled to be conducted on March 12, 2024. At this stage of exam preparation, it is crucial for students to revise all chapters of Physical Education thoroughly and practice a good number of Physical Education questions to assess their level of preparation.

In this article, we have provided the top 30 multiple-choice questions (MCQs) in physical education for CBSE Class 12 students. These questions are created in accordance with the most updated CBSE Class 12 Physical Education syllabus  2023–2024, previous year question papers, and sample papers. Through practicing these MCQs, students can evaluate their level of preparation and develop an efficient time management strategy for the final exam day.

CBSE Class 12 Physical Education Paper: Key  Highlights

Cbse class 12 physical education top 30 mcqs .

Q.1 Which of the following is not a procedure used in league fixtures?

(a) Cyclic method (b) Stair method (c) Ladder method (d) Tabular method

Answer. (c) Ladder method

Q.2. Match the following:

(a) Technical committee  (i) To provide shifting facility 

(b) Finance committee     (ii) To resolve dispute 

(c) Transport committee (iii) To deals with money and expenditure 

(d) First aid committee    (iv) To provide medical facility 

(a) a–ii, b–iii, c–i, d–iv  

(b) a–iii, b–ii, c–i, d–iv 

(c) a–ii, b–iii, c–iv, d–i 

(d) a–iv, b–iii, c–i, d–ii  

Answer. (a) a–ii, b–iii, c–i, d–iv 

Q.3. Which amongst the following is a lying asana? 

(a) Chakrasana 

(b) Vajrasana 

(c) Bhujangasana 

(d) Gomukhasana  

Answer. (c) Bhujangasana 

Q.4. Expanded form of ODD is: 

(a) Opposite different disorder 

(b) Oppositional defiant disorder

(c) Opposite different disability 

(d) Obsessive defect disability 

Answer. (b) Oppositional defiant disorder

Q.5. Kyphosis is commonly referred to as which of the following?

(a) Hollow back 

(b) Hunchback 

(c) Sideways bending 

(d) Lordosis

Answer. (b) Hunchback 

Q.6. Amenorrhea is a condition of:

(a) Menstrual Disorder 

(b) Eating Disorder 

(c) Psychological disorder 

(d) None of these 

Answer. (a) Menstrual Disorder 

Q.7. Breakage of bones is known as: 

(a) Sprain 

(b) Fracture

(c) Contusion 

(d) Laceration 

Answer. (b) Fracture

Q.8. Simple fracture is also known as:

(a) Compound 

(b) Closed fracture 

(c) Spiral 

(d) Transverse

Answer. (b) Closed fracture 

Q.9. Which of the following body type is needed for a long jumper?

(a) Endomorph 

(b) Ectomorph 

(c) Mesomorph 

(d) All of these 

Answer. (c) Mesomorph 

Q.10. Isotonic exercise helps in enhancing: 

(a) Strength 

(b) Speed 

(c) Agility 

(d) Endurance 

Answer. (a) Strength 

Q.11. Gliding movement occurs at which joint?

(a)  Hip

Answer. (c) Wrist

Q.12. Who discovered Vitamin A? (a) Dr. Mc Collum

(b) Dr. Harvard

(c) Dr. J.B.Nash

(d) Dr. Coubertin

Answer. (a) Dr. Mc Collum

Q.13. Which postural deformity has Convexities right or left? (a) Knock knees

(b) Flat foot 

(c) Scoliosis

(d) Kyphosis

Answer. (c) Scoliosis

Q.14. Halasana is used for curing which of the following deformities?

(a) Kyphosis

(b) Scoliosis

(c) Lordosis

(d) Flatfoot

Answer. (c) Lordosis

Q.15. What is the other name for Vitamin B2?

(a) Thiamin

(c) Folic Acid

(d) Riboflavin

Answer. (d) Riboflavin

Q.16. Which test is developed to test fitness in senior citizens? (a) Harvard step

(b) Rikli and Jones

(d) Rockport 

Answer. (b) Rikli and Jones

Q.17. What is the test duration for the Arm curl test? (a) 2 min

(d) Number of repetitions

Answer. (c) 30sec

Q.18. Which motor skill is involved in Smashing volleyball? (a) Cross motor skills

(b) Fine motor skills

(c) Gross motor skills

(d) Open skills

Answer. (b) Fine motor skills

Q.19. The laws of motion are given by:  (a) Galileo

(d) None of the above

Answer: (c) Newton

Q.20. The main cause for night blindness is :  (a) Deficiency of Vitamin C

(b) Deficiency of Vitamin E

(c) Deficiency of Vitamin A

(d) Deficiency of Vitamin  D

Answer. (c) Deficiency of Vitamin A

View and download the complete PDF of CBSE Class 12 Physical Education Top 30 MCQs by using the direct link given below: 

Important Study Material for CBSE Class 12 Physical Education Exam 2024

• CBSE Class 12 Physical Education Syllabus 2023 - 2024
• CBSE Class 12 Physical Education Previous Year Question Papers, Download PDF Here
• CBSE Class 12 Physical Education Practice Paper for Board Exam 2024, Download FREE PDF
• CBSE Class 12 Physical Education Sample Paper 2024
• CBSE Class 12 Physical Education Most Repeated Questions

Students appearing for the CBSE Class 12 Physical Education exam can also solve previous-year question papers and the latest sample papers to overcome exam fear and boost their confidence.

Also Read: CBSE Class 12 Date Sheet 2024 PDF (Revised) and Practical Dates

• Education News
• CBSE Class 10 Result 2024: Looking Back at Last 10 Years' Result Dates

CBSE Class 10 Result 2024: Looking Back at Last 10 Years' Result Dates

Visual Stories

Class 12 Biology Answer Key 2024, Get CBSE Board Paper Set 1, 2, 3

Using the CBSE Class 12 Biology Answer Key 2024,students can check their responses and predict their scores. The CBSE Class 12 Biology Answer Key 2024 for all sets 1,2,3, is shared here.

Table of Contents

As per the date sheet, the Central Board of Secondary Education (CBSE) has administered the Class 12 biology exam today 19 March 2024. As per the student’s reviews, The Class 12 Biology paper was easy. most of the questions were straightforward. After completing the exam, students would rush to acquire CBSE Class 12 Biology Answer Key 2024 to double-check their answers. If you took the exam today, bookmark this page so you can acquire the biology answer key for all sets as soon as possible.

Class 12 Biology Answer Key 2024

The Class 12 Biology exam hold for 3 hours from 10:30 a.m. to 1:30 p.m. The Class 12 Biology exam will run for three hours, from 10:30 a.m. to 1:30 p.m. After the exam, students search the Internet for the CBSE Class 12 Biology Answer Key 2024. To address this issue, the Adda247 Experience faculty has provided you with an unofficial Class 12 Biology Answer Key for all sets, along with a full explanation. So, instead of browsing random websites, stay tuned to receive the Class 12 Biology answer key as soon as possible.

CBSE Class 12 Biology Answer Key & Paper Pattern

Biology is one of the core and vital subjects for those students who opt for the science streams. The pattern of the biology paper will be the same as the sample paper provided by the board. The paper consists of 33 questions which are divided into five sections. Out of all the sections, section A comprises MCQs and assertion-reason-based questions which is the most scoring portion. Let’s take a look at the class 12 biology paper pattern given in the table below.

CBSE Class 12 Biology Answer Key for All Sets

The CBSE Class 12 Biology is now over. Students are now looking for the CBSE Class 12 Biology Answer key for their respective sets. Our Adda247 Subject experts are now evaluating the questions and answers of today’s biology board paper. The Biology answer keys on this page will be updated for each question paper set and QP code. The answer will help students tally their marked replies for Section A’s multiple-choice questions 1-16, each worth 1 mark. Check out the Biology Section A Answer key of all sets given below.

Class 12 Biology Answer Key 2024 Set 2

Question Set 57/2/1-12

Class 12 Biology Answer Key 2024 Set 1

Question Set 57/5/1

Class 12 Biology Paper Analysis 2024

The biology paper is concluded at 01:30 P.M. We spoke with the students after the exam, and based on their initial reactions, they rated the paper as simple to moderate in difficulty. Despite being NCERT-based, the paper was slightly lengthy. The paper included some expected and forthright questions. In the table below, you can find a detailed analysis of the CBSE 12th Biology test 2024 by section.

Class 12 Biology Answer key & Paper Analysis

In this video, Sonia Ma’am provides the complete analysis of the CBSE Class 12 Biology Question Paper. Watch the video Now.

CBSE Class 12 Biology Board Paper 2024 Set 1, 2, 3

Here we have provided the CBSE Class 12 Biology Question Paper PDF of all sets which will help students analyze the answer key. These papers also help students who are going to take the CBSE board exam in the upcoming academic session.

CBSE Class 12 Biology Questions and Answers Last year

Q. Given below is Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:

Choose the option where ART correctly matches with the procedure. 

a) (A)–(i), (B)–(ii), (C)–(iii), (D)–(iv) b) (A)–(iv), (B)–(i), (C)–(ii), (D)–(iii) c) (A)–(iv), (B)–(iii), (C)–(i), (D)–(ii) (d) (A)–(i), (B)–(iii), (C)–(iv), (D)–(ii) 

Correct Answer- (d) (A)-(i), (B)-(iii), (C)-(iv), (D)-(ii)

Q. The decrease in the T-lymphocyte count in human blood will result in:

a) Decrease in antigens b) Decrease in antibodies c) Increase in antibodies d) Increase in antigens 

Correct Answers- d) Increase in antigens

Q. At which stage evolution did humans use hides to protect their bodies and buried their dead?

a) Homo habilis b) Neanderthal man c) Java man d) Homo erectus Correct Answer- b) Neanderthal man

Q,The primary productivity in an ecosystem is expressed as:

a) gm-2 yr-1 b) K cal m-2 c) gm-2 yr d) Kcal m-2 yr-1

Correct Answer- (b) K cal m-2

Q, A Tight one-to-one relationship between many species of fig tree and certain wasps is an example of – 

(a) Commensalism (b) Parasitism (c) Amensalism d) Mutualism 

Correct Answers- d) Mutualism 

Q, Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.

Q‘ AUCAGGUUUGUGAUGGUACGA 5‘ 

• a) Phenylalanine, Methionine b) Cysteine, Glycine c) Alanine, Proline d) Serine, Valine 

Correct Answers- c) Alanine, Proline 

Q. Select the pathogen mismatched with the symptoms of disease caused by it from the  list given below

(a) Entamoeba histolvtica : Constipation, abdominal pain. (b) Epidermophyton: Dry scaly lesions on nail (c) Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb (d) Haemophilus influenzae : Blockage of the intestinal passage. Correct Answer- (d) Haemophilus influenzae : Blockage of the intestinal passage.

Q. A human male decides to adopt a surgical method for contraception. Identify the point in the diagram where a cut would be made and tied.

(a) 14-21                    1-7

(b) 10-17                   21-28

(c) 1-7                   14-21

(d) 21 28                   7-14

Answer: (b) Most fertile days: 10 – 17, Least fertile days: 21 – 28

Q. Which one of the following was not present during the Mesozoic Era of the geological time scale? (a) Ferns (b) Horsetails (c) Ginkgos (d) Bryophytes Answer: (a) Ferns

Q. Identify the element used by Hershey and Chase to label the protein in their experiment, from the following options:

(a) p32 (b) S32 (c) S35 (d) p35 Answer: (c) S35

Q. DNA profiles of the child and three individuals 1, 2 and 3 who claim to be the parents of the child are given below. Select the option that shows the correct actual parent/parents of the child.

(a) Individual 1 and 3 (b) Individual 1 and 2 (c) Individual 2 and 3 (d) Individual 1 is the only parent of the child amongst 1, 2 and 3 Answer: (b) Individual 1 and 2

Q. The given schematic illustration shows three steps ‘P’, ‘Q’ and ‘R’ of the polymerase chain reaction.

• Identify the fungus that ripens the famous ‘Roquefort’ cheese:

(a) Saccharomyces cerevisiae (b) Propionibacterium sharmanii (c) Monascus purpureus (d) Penicillium notatum Answer: To be Updated

• Select the options which is/are incorrect statement(s) with respect to T-lymphocytes in the human body.

(i) They are a type of white blood cells. (ii) They are produced in bone marrow. (iii) They remain active at all times in the body. (iv) They mature in the bone marrow.   (a) (i) and (iv) only (c) (iv) only (b) (iii) only (d) (iii) and (iv) only Answer: (a) (i) and (iv) only

• Which one among the following regions is not a hotspot of biodiversity?

(a) The Indo-Burma Region (b) Jaintia Hills in Meghalaya (c) The Western Ghats and Sri Lanka (d) The Himalayas Answer: (b) Jaintia Hills in Meghalaya

Q. Human settlement often leads to habitat loss which leads to fragmentation, forming smaller patches of habitats. Select the statements that describe how a small patch differs from a large patch of the same habitat.

(i) Invasive species will never be seen here. (ii) Population of large animals decreases. (iii)Biodiversity decreases. (iv) Competition from surrounding habitats increases.   (a) (ii), (iii) and (iv) only (b) (ii) and (iv) only (c) (i) and (iii) only (d) (i), (ii) and (iii) only Answer: (a) (ii), (iii), and (iv) only

Sharing is caring!

Where can I get CBSE Class 12 Biology Answer Key 2024?

The CBSE Class 12 Biology Answer Key 2024 for all sets is shared on this page.

What is total marks of biology theory paper?

The total marks of the biology theory paper is 70 marks.

Leave a comment

Your email address will not be published. Required fields are marked *

Save my name, email, and website in this browser for the next time I comment.

Trending Articles

• JEECUP Admit card 2024
• CBSE Date Sheet 2024 for Class 10 and 12
• NEET Syllabus 2024 [Reduced]

CBSE Board Exam 2024

• CBSE Class 10 Syllabus 2024 
• CBSE Class 12 Syllabus 2024 
• CBSE Previous Year Papers  
• CUET Syllabus
• CUET Previous Year paper
• CUET Participating College & Universities
• JEE Main 2024  
• JEE Main Syllabus 2024  
• JEE Main Exam Analysis 2023  
• NEET 2024  
• NEET Syllabus 2024
• NEET State wise Cut off
• NEET Rank Predictor  
• NEET OMR Sheet
• NEET College Predictor

Recent Posts

Important exams, ncert solutions.

• NCERT Class 12
• NCERT Class 11
• NCERT Class 10
• NCERT Class 9

NCERT Books

School syllabus.

• CBSE Class 12
• CBSE Class 11
• CBSE Class 10
• CBSE Class 9
• CBSE Result
• JEE Mains 2024

Our Other Websites

• Teachers Adda
• Bankers Adda
• Adda Malayalam
• Adda Punjab
• Current Affairs
• Defence Adda
• Adda Bengali
• Engineers Adda
• Adda Marathi
• Adda School

Get all your queries solved in one single place. We at Adda247 school strive each day to provide you the best material across the online education industry. We consider your struggle as our motivation to work each day.

Download Adda247 App

Follow us on

• Responsible Disclosure Program
• Cancellation & Refunds
• Terms & Conditions
• Privacy Policy